The beginning of gel extraction was carried out by using a razor to physically cut the bands of DNA out of the 4th PCR squared gels. The cut gel was then placed in a round bottom tube and stored in the -20 degree freezer.
4th PCR Squared (7/31/14)
A fourth PCR Squared was carried out in almost an identical manner to the 3rd PCR squared in order to run an Agarose gel for use in gel extraction. This time, 2 separate master mixes were made in order to ensure proper concentrations in hopes that the bands seen on this gel which can be used in gel extraction. The agarose gel used was made up .9 g of Agarose and 100 mL of TAE buffer. 6 well combs were used. All DNA was added to each well unlike the previous PCRs. Results are shown below.
The bright bands indicate a good result, and these gels will be used for gel extraction to purify the DNA within.
3rd PCR Squared (7/31/14)
A third PCR Squared was carried out in an identical manner to the 2nd PCR Squared in order to run an Agarose gel for use in gel extraction. A different Secondary PCR squared sample was used in hopes that the gel would exhibit bright uniform bands slightly below the 1.5 kb DNA Ladder mark. Results of this run are shown below
This gel was run much longer than normal which might have caused the result seen above. The concentration of DNA may have also been too low by accident during master mix preparation. This gel will not be used and a 4th PCR Squared will be carried out in hopes of a successful gel.
DNA Sequencing (7/31/14)
Samples 2, 3, 4, and 6 were sent to DNA sequencing using only the forward primer pLIC-for.
Results indicate failure as only the beginning and end of the AcpA sequence are matching when the Sequencing Results are blasted against the known sequence.
Mini-Prep (7/31/14)
Samples 1 - 7 of the cultures grown up overnight were purified using Mini-Prep for use in DNA Sequencing. Due to a shortness on time, all samples were only nanodropped once. Results are shown below.
Only samples 2, 3, 4, and 6 will be sequenced because their concentrations are high enough for an accurate result.
2nd PCR Squared (7/30/14)
A second PCR Squared was carried out in order to run an Agarose gel for use in gel extraction due to the previous cloning failures.
1 master mix with all of its contents doubled was used to create 8 tubes of 50 mL samples. The results of this run are shown below.
The result of this gel indicated that the master mix may have been improperly mixed. The DNA present is not enough to be utilized in gel extraction. A 3rd PCR squared will be carried out in order to attain a successful gel for use in gel extraction.
Master Plate and Cultures (7/30/14)
A master plate and cultures were made from colonies taken from plates A (2:4) & B (2:3) of the plates grown from 7/29/14 to 7/30/14.
Master Plate showing colonies 1 through 7 taken from plates A and B.
Cultures were not depicted, but all grew during overnight incubation.
Annealing and Transformation (7/29/14)
3 tubes were made in varying concentrations in order to find a combination that creates successful colonies when plated and incubated. Tubes-
A: 2:4
B: 2:3
C: 3:5
LB+Kan+Suc plates were then made with each of these cultures added. The plates were allowed to grow from 8 pm 7/29/14 to 5 pm 7/30/14
Plate A: 2:4 ratio of Accepting Vector to Insert. Colonies 1 - 6 are shown circled.
Plate B: 2:3 ratio of Accepting Vector to Insert. Colony 7 is shown circled.
Plate C: 3:5 ratio of Accepting Vector to Insert. There was no growth seen on this plate after incubation.
The circled colonies will be used to make the master plate and cultures.
Cohesive End Generation (7/29/14)
A cohesive end generation was done in order to start a new round of cloning incase the DNA sequencing comes back as a failure. The accepting vector was made using 9 uL of cut pNIC-Bsa4 with a concentration of 88.7ng/uL. (Someone else's cut pNIC)
DNA Sequencing (7/29/14)
A Forward and Reverse primer was sent for both Sample 1 and Sample 2.
Results indicated failure. A new round of cloning will be started.
MiniPrep (7/29/14)
Miniprep was done on cultures 1 and 2 of the second master plate and cultures in order to prepare them to be sent for sequencing. Results are shown below.
Second Master Plate and Cultures (7/28/14)
A new master plate was made using plate A from the second round of plates. Nine cultures were made at the same time using the same colonies that were used to make the plate. Cultures were made in 15 mL conical tubes due to a lack of round bottom culture tubes, and during the incubation, the caps of my samples came off. This possibly introduced contamination. Despite this, only 2 of the cultures made actually grew. The plate and cultures are shown below.
DNA Sequencing (7/25/14)
DNA Sequencing was done by adding forward or reverse primer to an appropriate amount of template for each sample. Blasts of the first 5 Blasts of my sequencing results vs. the AcpA DNA sequence are shown below. Sample 1 Forward Sample 2 Forward Sample 3 Forward Sample 4 Forward Sample 5 Forward
Week 8
MiniPrep (7/25/14)
The cultures which were allowed to incubate overnight were then used in MiniPrep in order to isolate the DNA within the Dh5alpha cells. Nanodrop results are shown below for all 9 samples. Sample 1 Sample 2 Sample 3: Sample 4: Sample 5: Sample 6: Sample 7: Sample 8: Sample 9:
Making a Master Plate (7/24/14)
A master plate and cultures were made with colonies from Plate C with a 2:3 ratio of Accepting Vector to PCR insert. The cultures were allowed to incubate at 37 degrees from 6 pm to 10:05 am on 7/25/14. All cultures exhibited growth, and all colonies grew.
Second Annealing and Transformation (7/24/14)
A second annealing and transformation was done in the case that the cloning done using the previous plates doesn't work. Tubes
A: 2uL AV & 4uL Insert
B: 1uL AV & 5uL Insert
C: 2uL AV & 5uL Insert
These tubes were allowed to shake from 3:57 pm to 4:57 pm.
The plates were allowed to incubate from 6:44 pm on 7/24/14 to 5:00 pm 7/25/14
The next step is to MiniPrep the cultures and store the MasterPlate in the 4 degree fridge. Re-do of Cohesive End Generation (7/24/14)
A second cohesive end generation was done in order do a second annealing and transformation in the case that the previous transformation doesn't work.
The result of the second cut pNIC was used as the accepting vector in this procedure.
Annealing and Transformation (7/23/14)
This procedure was done with three tubes with different ratios of Accepting Vector to Insert in order to hopefully grow up colonies for use in cloning. Tubes
A: 2uL AV - 4uL Insert
B: 1uL AV - 5 uL Insert
C: 2uL AV - 3uL Insert
These tubes were allowed to shake from 3:44 pm to 6:30 pm due to an unavailability of plates until the time that the tubes were taken out.
The plates were allowed to incubate from 6:44 pm on 7/23/14 to 5:00 pm on 7/24/14
Re-Do of Preparation of pNIC-Bsa4 as the Accepting Vector (7/23/14)
This procedure was done a second time in order to attain a more concentrated result for use in the case that the cloning is not successful. Results are shown below.
Figure 1. Results of Samples 1 and 2 for both tubes of PCR cleaned cut pNIC-Bsa4. The concentrations seen for each of the samples are good and indicate that these samples may be used for cohesive end generation.
Cohesive End Generation (7/23/14)
Cohesive End Generation was done for the PCR Inserts as well as the Accepting Vector for use in Annealing and Transformation. The PCR inserts were done with sample from the PCR Cleanup of PCR Squared. The Accepting Vector was made with 14 uL from the cut pNIC-Bsa4 made in a previous procedure.
Agarose Gel Run of the cut pNIC-Bsa4 (7/23/14)
An agarose gel run of 10 uL of the cut pNIC-Bsa4 was done in order to ensure that what was in solution was in fact pNIC-Bsa4 and not some form of contamination.
Figure 1. Results of Agarose Gel run of sample of pNIC-Bsa4 cut with BsaI-HF. There are two distinct bands showing to places where the pNIC-Bsa4 was cut by the BsaI-HF. The 1 kb Ladder Present in lane 1 seems to not have separated enough for proper use as a reference regarding what sizes the cuts are.
Cidia Gonzalez
07/23/14
RE Digest of pNIC-Bsa4 with BsaI-HF
Lane 1: 1 kb DNA Ladder
Lane 2: Sample of pNIC-Bsa4 cut with BsaI-HF
The results of this gel indicate that what was in solution was a correctly cut pNIC-Bsa4. Since the procedure was successful, this solution will be used for Cohesive End Generation.
Preparation of pNIC-Bsa4 as Accepting Vector (7/22/14)
The vector pNIC-Bsa4 was cut with the enzyme BsaI-HF in order to prepare it to be the accepting vector of the FtAcpa_1 DNA. Results of this procedure after PCR Cleanup are shown below.
Figure 1. Results of Nanodrop for samples 1 and 2 for tubes 1 and 2 of PCR cleaned cut pNIC-Bsa4. The concentrations seen for these samples are low which is likely due to the use of 50 uL of elution solution during PCR cleanup.
These concentrations, despite being low, are still usable for cohesive end generation. A second round of this procedure will be done, but I will also move forward to C.E.G.
PCR Cleanup (7/21/14)
PCR Cleanup was done in order to isolate the DNA present from PCR squared. Results are shown below.
Figure 1. Sample 1 of PCR squared PCR clean up results shown nanodropped in the graph above. The concentration of this sample is seen to be 139.5 ng/uL which is a good yield of purified DNA.
Figure 2. Sample 2 of PCR squared PCR clean up results shown nanodropped in the graph above. The concentration of this sample is seen to be 140.5 ng/uL which is a good yield of purified DNA.
The average concentration of the PCR Cleaned PCR squared is seen to be 140 ng/uL. This concentration of DNA indicates a good yield which can then be used in cohesive end generation for the PCR inserts.
PCR Squared (7/21/14)
A PCR Squared run was performed using sample 1 of the 10th secondary PCR in order to further amplify the DNA of FtAcpA_1. The annealing time and temperature were 30 seconds and 50 degrees Celsius respectively. The elongation time was set to 50 seconds. The samples were then ran on an agarose gel to view the amplification.
Figure 1. Results of an agarose gel run of PCR squared samples run with an annealing temperature of 50 degrees Celsius and an annealing time of 30 seconds. Elongation time was 50 seconds. Results are appropriate as seen on this gel.
Cidia Gonzalez
07/21/14
PCR Squared
Lane 1: 1 kb DNA Ladder
Lane 2: PCR squared sample 1
Lane 2:PCR squared sample 2
Lane 3: PCR Squared Sample 3
Lane 4:PCR Squared sample 4
Week 7
10th Secondary PCR (7/18/14)
A tenth secondary PCR was done with a temperature gradient between 51 and 60 degrees Celsius. The elongation step was increased to 50 seconds, and the annealing step was increased to 30 seconds. For this run, the primers were rediluted in hopes that this would improve the result.
Figure 1. Results of agarose gel run of secondary PCR samples run on a gradient from 51 degrees Celsius to 60 degrees celcius with an annealing time of 30 seconds and an elongation time of 50 seconds. In lane 1 is a 1 kb DNA ladder. In lanes 2-9 are samples 1 through 8 of secondary PCR. Bands are seen in the appropriate place for all samples except sample 4 which was incorrectly pipetted into the well before running the gel. These results are viable for use in PCR squared.
Cidia Gonzalez
07/18/14
10th Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR Sample (51 degrees)
Lane 3: Secondary PCR Sample (51.9 degrees)
Lane 4: Secondary PCR Sample (53.1 degrees)
Lane 5: Secondary PCR Sample (54.6 degrees)
Lane 6: Secondary PCR Sample (56.6 degrees)
Lane 7: Secondary PCR Sample (58.3 degrees)
Lane 8: Secondary PCR Sample (59.4 degrees)
Lane 9: Secondary PCR Sample (60 degrees)
The results of this run indicate success and will be used in PCR squared to further amplify the DNA. The light bands seen at 3.0 kDa are perhaps contamination or some kind of clumping of the DNA. Since sample one at 51 degrees appears to have the least contamination, this sample will be used for PCR squared. The PCR squared will be done with an annealing temperature of 50 degrees Celsius and an annealing time of 30 seconds. The elongation time will be 50 seconds. After the PCR squared is done, the samples will be ran on an Agarose gel to view the amplification.
9th Secondary PCR
A 9th secondary PCR was done with a temperature gradient between 53 and 63 degrees Celsius. The elongation step was increased to 50 seconds.
A picture was not taken for this gel run, but the result was a clean gel with no bands or smears in any of the lanes. The error made in this run was most likely due to improper mixing of the samples prior to PCR.
8th Secondary PCR
AN 8th Secondary PCR was done with a temperature gradient between 52 and 61 degrees Celsius. The elongation step was increased to 50 seconds. Figure 1. Results of agarose gel run of secondary pcr samples for Chris T. and Cidia G. In lane 1 is a 1 kb DNA ladder. In lane 2 is the secondary pcr sample for Chris T. In lanes 3 through 10 are secondary pcr samples 1 -8 for Cidia G. There is a small smear low on the gel in lane 2 for Chris’ sample, which is not the expected result. There are no bands or smears in lanes 3 through 10 indicating failure for Cidia G. Cidia G. / Chris T.
07/17/14
Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR sample for Chris T.
Lane 3: Secondary PCR sample 1 (Cidia G.)
Lane 4: Secondary PCR sample 2 (Cidia G.)
Lane 5: Secondary PCR sample 3 (Cidia G.)
Lane 6: Secondary PCR sample 4 (Cidia G.)
Lane 7: Secondary PCR sample 5 (Cidia G.)
Lane 8: Secondary PCR sample 6 (Cidia G.)
Lane 9: Secondary PCR sample 7 (Cidia G.)
Lane 10: Secondary PCR sample 8 (Cidia G.)
Nothing was seen in my lanes for these samples, and this is likely due to PCR error. Another secondary PCR will be done to hopefully get a good result.
Fourth Primary PCR
A primary PCR was done using the remade oligo mix in order to attain a result usable in continuing Secondary PCR.
Figure 1. Results of Agarose gel run of Primary PCR samples made using new oligo mix for Cidia Gonzalez, Nikki Weber, and Chis Tran. In lane 1 is a 1 kb DNA ladder. In lane 2 is the primary PCR sample for Cidia G. In lane 3 is the primary PCR sample for Nikki W. In lane 3 is the primary PCR sample for Chris T. The fact that the lanes are showing bands and not smears as expected is not normal. The cause of this will need to be determined before these results may be used in secondary PCR or discarded.
Cidia Gonzalez/ Nikki Weber/ Chris Tran
07/16/14
Primary PCR with New Oligo Mix
VDS Summer 2014
Lane 1: 1 kb DNA Ladder
Lane 2: Primary PCR sample (Cidia G.)
Lane 3: Primary PCR sample (Nikki W.)
Lane 4: Primary PCR sample (Chris T.)
Remaking Oligo Mix
Oligo mix was remade using 1 microliter each of Plate A: Wells E5-H6 and 62 microliters of water.
Seventh Secondary PCR
A seventh Secondary PCR was done with a temperature gradient and 8 samples in order to attain a viable result for use in PCR squared.
Figure 1. Results of agarose gel run of 7th Secondary PCR with a temperature gradient on the annealing step between 56 and 63 degrees Celsius. In lane 1 is a 1 kb DNA Ladder. In lanes 2 through 9 are samples 1 – 8 of Secondary PCR. No bands are seen which is most likely due to error during PCR. 31.5 uL of water was probably not added to each sample before PCR was begun, which is possibly the reason that no bands are seen.
07/16/14
7th Secondary PCR
Cidia Gonzalez
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR Sample 1 (56 degrees)
Lane 3: Secondary PCR Sample 2 (56.7 degrees)
Lane 4: Secondary PCR Sample 3 (57.6 degrees)
Lane 5: Secondary PCR Sample 4 (58.8 degrees)
Lane 6: Secondary PCR Sample 5 (60.4 degrees)
Lane 7: Secondary PCR Sample 6 (61.7 degrees)
Lane 8: Secondary PCR Sample 7 (62.5 degrees)
Lane 9: Secondary PCR Sample 8 (63 degrees)
The results of this run are most likely due to the accidental omission of 31.5 uL of autoclaved nanopure in each sample before PCR. Oligo mix will be remade and primary PCR will be redone in order to continue secondary PCR.
Sixth Secondary PCR
A sixth Secondary PCR was done with a temperature gradient and 8 samples in order to attain a viable result for use in PCR squared.
Figure 1. Results of Agarose Gel of Samples 1 – 8 of the 6th Secondary PCR done with a temperature gradient between 57 degrees Celsius and 64 degrees Celsius. Bands are shown in all lanes; However, the position of the bands on the gel indicates a much smaller size of DNA is being amplified than what the target should be.
07/15/14
Cidia Gonzalez
Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Sample 1 (57 degrees)
Lane 3: Sample 2 (57.7 degrees)
Lane 4: Sample 3 (58.6 degrees)
Lane 5: Sample 4 (59.8 degrees)
Lane 6: Sample 5 (61.4 degrees)
Lane 7: Sample 6 (62.7 degrees)
Lane 8: Sample 7 (63.5 degrees)
Lane 9: Sample 8 (64 degrees)
The bands seen above are similar in size to the bands seen in the 5th secondary PCR which is indicative of failure. Another PCR will be done with a temperature gradient similar to this one but with a longer elongation step in hopes of amplifying a larger segment of DNA.
Fifth Secondary PCR
A fifth Secondary PCR was done with a temperature gradient and 5 samples in order to attain a viable result for use in PCR squared.
Figure 1. Results of Agarose Gel run of the 5th Secondary PCR samples 1-5. A 1 kb DNA Ladder is in lane 1, and samples 1-5 are in lanes 2 through 6. The bands seen in lanes 3 and 4 are a successful result, and sample 2 in lane 4 will be used for PCR squared.
Cidia Gonzalez
07/14/14
Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR Sample 1
Lane 3: Secondary PCR Sample 2
Lane 4: Secondary PCR Sample 3
Lane 5: Secondary PCR Sample 4
Lane 6: Secondary PCR Sample 5
Temp Gradient from 55.5 to 59 degrees Celsius.
There is no certainty regarding which sample received which temperature.
After further analysis, the result of this PCR was proved to be a failure of sorts as the bands seen are too small in size. Ideally, the bands should be higher in the gel relative to the ladder to indicate the larger amplified DNA. Another Secondary PCR will be done with a larger gradient in hopes of achieving a viable result.
Fourth Secondary PCR
A fourth Secondary PCR was done in order to attain a viable result for use in PCR squared.
Figure 1. Results of Agarose Gel of 4th Secondary PCR Sample with no viable results displayed in the 2nd lane where the 4th secondary PCR sample was placed. The result may be due to improper PCR and a temperature gradient may be added to the protocol in order to achieve a result.
07/14/14
Cidia Gonzalez
Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR Sample
The results seen here indicate failute and the PCR protocol will be further modified to incorporate a temperature gradient from 55.5 degrees Celsius to 59 degrees Celsius for 25 seconds as the annealing step with 5 individual samples.
Week 6
Third Secondary PCR
A third Secondary PCR was done in order to attain a viable result for use in PCR squared.
Figure 1. Third run of Secondary PCR on target. In lane 2 is a 1 kb DNA ldder. In lanes 3 and 4 are Charina's RE Digest samples. Lane 5 is empty. Lane 6 is Nikki and Carolyn's Secondary PCR sample. Lane 7 is empty. In lane 8 is Cidia's Secondary PCR sample. Results appear unsuccessful for Secondary PCR samples seen in lanes 6 and 8.
Nikki W., Carolyn T., Cidia G.
7/11/14
VDS Summer 2014
Secondary PCR
Lane 1: Empty
Lane 2: 1 kb DNA Ladder (5 uL)
Lane 3: RE Digest Sample #1 (Charina)
Lane 4: RE Digest Sample #2 (Charina)
Lane 5: Empty
Lane 6: Secondary PCR sample (Nikki & Carolyn)
Lane 7: Empty
Lane 8: Secondary PCR sample (Cidia)
Since this secondary PCR was unsuccessful, the PCR protocol annealing step will be modified to better fit the target and primers in order to hopefully achieve a positive result.
Second Secondary PCR
A second Secondary PCR was done in order to attain a viable result for use in PCR squared.
Figure 1. Secondary PCR samples for Andee, Nikki, Carolyn, and Cidia. The first lane is skipped while the second lane has a 1 kb ladder. Lane three has Andee’s secondary PCR (EhPTP) while the following lanes are Nikki and Carolyn’s secondary PCR and Cidia’s secondary PCR. A visible band is seen for Andee’s samples while the following two samples did not result in bands, indicative that secondary PCR was not successful.
Andee F., Cidia G., Nikki W. and Carolyn T.
07/10/14
Secondary PCR
Lane 1: empty
Lane 2: 1 kb ladder
Lane 3: Andee’s PCR sample
Lane 4: Nikki and Carolyn’s PCR sample
Lane 5: Cidia’s PCR sample
Remaining lanes: empty
There were no bands seen for this gel run which would be due to improper mixing of sample or inefficient PCR. PCR may have to be modified according to the specific primers and gene in order for it to work. A third secondary PCR will be done before PCR is modified to hopefully attain a viable result.
First Secondary PCR
Secondary PCR was done to amplify the full length gene from the pool of DNA fragments in the Primary PCR reaction.
Figure 1. Agarose gel of Secondary PCR. Lane 1 is empty. Lane 2 contains the DNA 1kb ladder, lane 3 has 12 uL secondary PCR sample (Nikki & Carolyn) and lane 4 has 12 uL secondary PCR sample (Cidia).
7/10/14
VDS Summer
Cidia, Nikki & Carolyn
Lane 1: Empty
Lane 2: 1kb DNA Ladder
Lane 3: Secondary PCR Nikki W & Carolyn T.
Lane 4: Secondary PCR Cidia
Nothing showed up in either lane which is likely due to improper mixing of the sample prior to PCR. A new secondary PCR will be done in hopes of attaining a viable result for use in PCR squared.
2nd Re-Do of Primary PCR
Primary PCR was done a third time in an identical manner to the two previous times in order to attain a viable result for use in secondary PCR.
Figure 1. Results of 3rd Primary PCR of Andee’s sample in lane 3 and Cidia’s sample in lane 4. In lane 2 is a 1 kb DNA Ladder. The absence of any result in lane 3 where Andee’s sample should have shown is most likely a result of improper mixing of the sample before PCR. An additional Primary PCR will need to be done in order to get a result viable enough to use in Secondary PCR. The smear seen in lane 4 is the expected result with a high enough yield to continue on to Secondary PCR.
07/09/14
Primary PCR
Andee F. / Cidia G.
Lane 1: Empty
Lane 2: 1 kB DNA Ladder
Lane 3: Primary PCR Sample (Andee F.) Lane 4. Primary PCR Sample (Cidia G.)
Tail Primer Dilution
Tail Primers were diluted from the powder to a liquid solution using appropriate amounts of TE Buffer in order to reach a stock concentration of 100 mM for long term storage. The stock solution was then diluted to 20mM by adding 160 microliters of 10 mM Tris with a pH of 8.0 to 40 microliters of stock.
FtAcpA
1st Re-Do of Primary PCR
Primary PCR was done in an identical manner to the previous run in order to attain a viable result for secondary PCR.
Figure 1. Results of Agarose Gel run of primary PCR samples in lanes 3 and 4 for Andee and Cidia and PCR squared samples in lanes 6-9 for Brianna. A 1 kn ladder is shown in lane 2. The results seen in lanes 3 and 4 are not ideal, but do not suggest failure. Light smears are seen which are not undesired results. However, darker smears would be indicative of concentrations high enough to move on to secondary PCR. The PCR Squared samples seen in lanes 6 through 9 are the desired result with possible contamination or uncompleted assembly of the gene seen in several places in each lane.
Cidia Gonzalez / Andee Fonseca / Xenia Gonzalez
07/08/2014
Primary PCR / PCR Squared
Lane 1: Empty
Lane 2: 1 kb DNA Ladder
Lane 3: Primary PCR Sample (Andee F.)
Lane 4: Primary PCR Sample (Cidia G.)
Lane 5: Empty
Lane 6: PCR Squared KpblaGES5 (Xenia G.)
Lane 7: PCR Squared KpblaGES5 (Xenia G.)
Lane 8: PCR Squared KpblaGES5 (Xenia G.)
Lane 9: PCR Squared KpblaGES5 (Xenia G.)
Restriction Enzyme Digest
A restriciton enzyme digest was done on the plasmid pGBR22 with the enzymes EcoRI and PvuII both separately and together. All 3 samples were run in order to view the results of a restriction enzyme digest for future reference. The result is seen below.
Figure 1. Results of agarose gel run of samples of pGBR22 cut with restriction enzymes EcoRI, PvuII, and with both EcoRI and PvuII. In lane 2 is the 1 kb DNA ladder. In lane 3 is the uncut pGBR22 with a concentration of 100 ng. Lanes 4-6 are Andee’s samples of plasmid and restriction enzyme with 4 having only EcoRI, 5 having PvuII, and 6 having both EcoRI and PvuII. The results seen above for these lanes are ideal as there are clear bands in the expected positions based on the segments created after digest with the specific enzyme or enzymes. Lanes 7-9 are Cidia’s samples of plasmid and restriction enzyme with 7 having only EcoRI, 8 having PvuII, and 9 having both EcoRI and PvuII. The results seen above for these lanes are not ideal as there are contaminating bands seen below the first cuts shown in lanes 8 and 9. Other than these bands, the bands shown are appropriate based on the segments created after digest with the specific enzyme or enzymes.
07/08/2014
Cidia Gonzalez / Andee Fonseca
Restriction Enzyme Digest
Lane 1:Empty
Lane 2: 1 kb DNA Ladder
Lane 3: Uncut plasmid pGBR22 (100 ng)
Lane 4: pGBR22 with EcoRI (AndeeF.)
Lane 5: pGBR22 with PvuII (Andee F.)
Lane 6: pGBR22 with EcoRI and PvuII (Andee F.)
Lane 7: pGBR22 with EcoRI (Cidia G.)
Lane 8: pGBR22 with PvuII (Cidia G.)
Lane 9: pGBR22 with EcoRI and PvuII (Cidia G.)
Week 5
Concentrating Results of FPLC and Storage
The two 15mL conical tubes taken as a result of FPLC done yesterday were concentrated in concentration tubes run at 8000 g's for 10 minutes until all had been concentrated. After all was concentrated, nanodrop was done on the concentrated tubes for analysis, and the tubes were stored.
FPLC
FPLC Gel Filtration was done in order to further purify the protein present in Elution 1 which was obtained by using Ni-NTA affinity purification. This filtration was done based on differences in size. In order to prepare the sample for FPLC, it was concentrated to 1 mL in a concentrating tube at 8,000 g's for 20 minutes. Once concentrated, the sample was poured into a microcentrifuge tube and taken to the biotech lab for FPLC. FPLC was run according to protocol with no changes. After FPLC, tubes 29 though 37 were taken and placed into a 15 mL concical tube due to the peak that was present at 44 kDa, and tubes 39 through 46 were taken and placed into a 15 mL conical tube due to the peak that was present at 33 kDa which is most likely the protein of YopH. The 44 kDa peak is most likely another protein as YopH is somwhere close to 32 or 33 kDa.
Results of FPLC run
pLIC Gel Run
An agarose gel was run for the samples obtained after running the pLIC PCR yesterday. The sample was ran in a 1% agarose gel with a 1kb ladder. The gel was run at 105V for approcimately 35-40 minutes until the sample was about 3/4 of the way down the gel. After the gel was done, it was photographed with the UV viewer.
Figure 1. Results of the agarose gel run of pNIC-Bsa4 for Cidia on the left and Andee on the right. The 1 kb ladders are visible in lanes 1 and 6. Samples A-D for Cidia are shown in lanes 2 through 5. Samples A-D for Andee are shown in lanes 7-10. There are what we believe to be contaminated bands seen in lanes 7 and 8 around the 1.0 mark of the ladder. The pNIC bands are shown in lanes 2-4 for Cidia and in lanes 7-9 for Andee slightly above the 2.0 mark of the ladder. The increasing concentrations of the DNA in each subsequent lane are appropriate results relative to the increasing concentrations of samples 1-C. Lanes 5 and 10 show no bands in the region where pNIC would be due to Sample D being a control containing no template.
Lane 1: 1 kb DNA Ladder
Lane 2: 0.0196 ng pNIC-Bsa4 (Cidia G.)
Lane 3: 0.196 ng pNIC-Bsa4 (Cidia G.)
Lane 4: 1.96 ng pNIC-Bsa4 (Cidia G.)
Lane 5: No template control (Cidia G.)
Lane 6: 1 kb DNA Ladder
Lane 7: .0362 ng pNIC-Bsa4 (Andee F.)
Lane 8: 0.362 ng pNIC-Bsa4 (Andee F.)
Lane 9: 3.62 ng pNIC-Bsa4 (Andee F.)
Lane 10: No template control (Andee F.)
Primary PCR Gel Run
An agarose gel was run for the sample obtained after running Primary PCR yesterday. The sample was ran in a 1% agarose gel with a 1kb ladder. The gel was run at 105V for approximately 45 minutes until the sample was about 3/4 of the way down the gel. After the gel was done, it was photographed with the UV viewer. When running this gel, only half of the sample should have be used. Since we used all of the sample, we had to add a larger amount of gel loading buffer. We will need to run a second Primary PCR in order to run our Secondary PCR.
Figure 1. Results of agarose gel run of the primary PCR samples for Cidia on the left and Andee on the right. Lanes 1 and 4 show a 1 kb DNA ladder. Lane 2 shows the primary PCR sample for Cidia, and lane 5 shows the primary PCR sample for Andee. The smeared look of the samples in the these lanes is the expected result due to the nature of the sample.
Lane 1: 1 kb DNA Ladder
Lane 2: Primary PCR Sample (Cidia G.)
Lane 3: Empty
Lane 4: 1 kb DNA Ladder
Lane 5: Primary PCR Sample (Andee F.)
Lane 6: Empty.
Making FPLC Buffer
FPLC buffer was made using 6.06 g of Tris, 8.77g of NaCL, and 154.25 mg of DTT. DTT was not necessary, but was added due to obtaining the incorrect protocol. The DTT used was stored within the cabinet near the flammables cabinet and was not stored within the 4 degree fridge as it should have been. The pH of the buffer was then brought down to 8.0 by the addition of HCl to make it more acidic. The buffer was then ran through a bottle top filter in order to remove impurities and was then degassed for approximately 20 minutes.
pLIC PCR
PCR was done in order to amplify pNIC-Bsa4 using the primers pLIC-for and pLIC-rev. The samples were prepped according to protocol and thermocycled according to protocol. After PCR was done for these samples, the samples were stored in the -20 degree freezer overnight for running an agarose gel the next day.
Primary PCR
PCR was done in order to fill the gaps between my oligos and piece together a full DNA sequence by adding appropriate amounts of 5x reaction buffer, 2mM dNTPs, oligo mix, 1U/uL Q5 hotstart polymerase, and sterile dH2O to a microcentrifuge and then thermocycling according to protocol. The tube was then stored in the -20 degree freezer overnight for running an agarose gel the next day.
Making Oligo Mix
Since the oligos of my CDS came in, oligo mix was made by added 57 microliters of autoclaved nanopure to a microcentrifuge tube and then adding 1 microliter of each stock primer from the oligo box according to the wells that were designated for my target.
Tail Primers Design and Order
Tail primers were designed for my target, a secreted phosphatase of the organism Francisella tularensis and placed on the wish list for later ordering. Primers were designed in order to incorporate my target into the organism pNIC-Bsa4 for PCR amplifying the CDS of my gene of interest.
TACTTCCAATCCATGGACGTGAATAATTCTAAGCCGAACGATTACGGTACCCTGGTTAAAATCGAACAGAAA CTGTTTAACAACGCGAATACGCTCAAAACGACCACCCCGATTAAACACGTAGTCATTATC TTCCAGGAGAATAACTCTTTTGATCGTTACTTCGGTATGTACCCGAATGCGAAGAATCCG GAAGGTGAACCAAAGTTTGTTGCGAAAGAAAACACCCCAAATGTTAACGGCCTCACCAAA CAGCTGCTCGAAAATAACCCGAACACCAAAAATCCGTACCGCCTGGATCGCAACTTCCAG CCGTGCTCTCAGAACCACGAATACCACCAGGAAATCTCTTCTTTCAATGGTGGCCTGATG AATAAGTTCGTCGAACATGGTGGTCACGACAATGACACCTACAAACAGAATTGCGATGGT CAGGTGATGGGCTACTATGATGGCAATACTGTTACCGCGCTGTGGAATTACGCGCAGAAC TTCGCGCTGAATGACAACACCTTTGGTACTACCTTCGGTCCGTCTACCCCGGGTGCCCTG AACCTGGTTGCGGGTGCAAACGGTCCGGCGATGTCTCCGTCTGGCAACCTCGAGAACATC GAAAACAACTACATCATTGACGACCCTAACCCGTATTATGACGACTGCTCTTACGGCACC TCTAAATCTGGCGACACCAACACTGCGGTTGCTAAGATCACGGATGGTTACAACATCGGT CACTACCTCACCCAAAAAGGTATCACTTGGGGTTGGTTTCAAGGCGGCTTCAAACCGACC TCTTACTCTGGTAAGACGGCGATTTGTGACGCCATGTCTACCAACAAGTTCGGTGTTAAA TCTCGTGACTATATCCCGCACCACGAGCCTTTCAACTATTGGAAGGAGACCTCCAATCCA CACCACCTCGCGCCGAGCGACGACAAATACATTGGTTCTAATGATCAAGCGAATCACCAA TACGACATCTCTGAATTCTGGAAGGCGCTCGACCAGAACAACATGCCTGCCGTTTCTTAC CTGAAAGCTCCGGGTTACCAGGATGGCCACGGTGGCTACTCCAACCCACTGGACGAACAG GAATGGCTCGTTAATACCATCAACCGTATCCAGCAGTCTAAAGACTGGGACTCTACCGCT ATTATCATCATTTACGATGACAGCGACGGTGATTACGATCACGTTTACTCTCCAAAGTCT CAATTCTCTGACATCAAGGGCCGTCAAGGTTATGGTCCGCGTCTGCCGATGCTGGTTATC AGCCCGTATGCAAAAGCTAACTACGTTGACCACTCTCTGCTGAATCAGGCGTCTGTCCTG AAATTCATCGAATACAACTGGGGTATCGGTTCCGTATCTAAATACTCTAACGACAAGTAT TCTAACAATATCCTGAATATGTTTGACTTCAACAAAGAGCAAAAAACCCTGAAACTGATC CTGGACCCGAAAACTGGTCTCGTTATGGATAAACTGAACTAACAGTAAAGGTGGATA
Filtered DNA of my target CDS with tail primers added and highlighted.
Primers ordered shown above as the "Forward Primer" and the "Reverse Complement" of the Reverse primer. These were made by attaching the primer sequences to the first and last 18-20 bp of the sequence.
Ordered primers were: FtAcpA_1-for and FrAcpA_1-rev
Week 4
Protein Characterization
Characterization was done by running samples 0 through 6 with an SDS Page gel which was made previously. The samples were prepped according to protocol and the gel was placed into the tank filled with buffer. Samples were then added between the glass plates into the wells and the gel was run at 200V for approximately 35-40 minutes until the samples were visibly at the lower part of the gel. After the electrophoresis was done, the gel was removed, stained, and dried according to protocol.
Figure 1. Characterization Results of gel electrophoresis of YopH samples taken over the course of Expression and Purification. What is in each lane is clearly marked in the image. Elution 1 and Elution 2 are of the most importance as this is where the purified protein is supposed to be present. In lane 8 where elution 1 is present, the bands other than the large dark one should not be present. The yopH protein is clearly present more strongly than other proteins, though. This is a favorable result. There is also some of the YopH protein present in the elution 2, but the concentration in this sample was less than that of Elution 1.
Making SDS Page Gel for Protein Characterization
SDS Page gel was made using a 12% resolving/separating gel and a 5% stacking gel. Before the addition of the resolving/separating gel, the gel drying stand kept leaking due to a small crack in the larger glass plate which enabled fluid to seep out. After replacing the slide, the gel no longer leaked and was made according to protocol.
Protein Purification
The protein was purified by Ni-NTA affinity purification through a series of filtration steps involving Ni-NTA buffer, a nickle column, and wash and elution buffers. Samples 3 through 6 were taken during this procedure after certain steps. After elutions 1 and 2 were taken, the OD of each was measured at 280 nm on the spectrophotometer.
Figure 1. Results of Nanodrop to determine the concentration of protein found in Elutions 1 and 2 which were obtained after protein purification. Elution 1 shows a good concentration of protein at 2.67 mg/mL measured at 280 nm. Elution 2 shows a good concentration of protein at .79 mg/mL measured at 280 nm. The concentration of protein elution 1 was expected to be higher than that of elution 2. Ideally, the concentration of elution 2 should be closer to zero as most of the protein should have come out in the first elution.
Re-Do of Agarose Gel (Third Time)
An agarose gel run of the samples made as a result of PCR done earlier today was carried out as a result of yesterday's unsuccessful gel.
This gel was ran almost identically to the one ran yesterday with the exception of the voltage which, for the third gel, was 105V. After the gel had
been running for approximately 1 minute, a 1000kb DNA ladder was added to well 10 of the gel. This addition did not float to the bottom of the gel as expected,
most likely due to the fact that the gel was already running. The results of the gel are shown below:
Re-Do of PCR (Third Time)
PCR was done a third time due to the unsuccessful gel ran yesterday. This procedure was ran identically to the procedure ran yesterday.
Re-Do of Large Culture Expression & Inoculation
YopH+pNIC Bsa4 in BL21(DE3) was grown up overnight in two 250 mL flasks with 50 mL of LB Media and 50 microliters of
Kanamycin in each. In the morning, 500 mL of LB and 500 microliters of Kan were placed in a 2L flask and the following additions and readings
were made:
Added: 16 mL YopH/ Reading 1: 0.046
Added: 8 mL YopH/ Reading 2: 0.095
Added: 0 mL YopH/ Reading 3: 0.085
Added: 1 mL YopH/ Reading 4: 0.085
Added: 1 mL YopH/ Reading 5: 0.101
Incubated for 45 minutes/ Reading 6:
Incubated for 30 minutes/ Reading 7:
Incubated for 15 minutes/ Reading 8:
Incubated for 9 minutes/ Reading 9:
258.5 microliters of IPTG added
Flask was placed to incubate for 4 hrs until 5:35 PM
Culture was then placed into a 500 mL cylindrical bottle and centrifuged at 5800 rpm for 20 minutes.
Centrifuged on J20 rotor setting instead of J10 by accident.**
Supernatant was then trashed, and cell pellet was weighed and found to be 2.43 grams.
Cell pellet was then resuspended in lysis buffer, transferred to a 15 mL conical tube, and stored in the -80 degree celsius freezer.
Second Gel Run
The second gel run was done with 5 mL of gel loading buffer in each sample tube. 20 mL of each sample
with blue juice were put into each well. The gel was ran at 100V for approximately 40 minutes until the samples were about 3/4
of the way down the gel. The results of this gel are shown below:
Second PCR
A second PCR was done today so that a second gel may be run due to the failure of the last agarose gel run.
This PCR procedure was done using the same materials as the last PCR to achieve a similar result which will
hopefully provide a viable result following the gel run.
DNA Sequencing Analysis
The DNA sequencing results of pGBR22 with the primer M13 Reverse were analyzed against the known sequence to
determine if the sequence found through sequencing was correct. The portion of the pGBR22 that was read by the M13
Reverse was then placed into the pGEMt backbone. The results of a gel senario involving certain enzymes and the plasmid
were then also analyzed.
Week 3
Results of Making Plates of LB Agar + Amp
After making and autoclaving 200 mL of LB Agar, 400 microliters of Ampicillin were added. The LB+Amp
was then transferred onto 10 different plates with each plate having 20 mL each. Upon wrapping the plates
with saran wrap for storage in the 4 degree fridge, five of the plates fell. Four of the five were compromised and
thrown away, but one was saved and stored for a total of six stored plates.
Results of Transformation of Competent Cells for Plasmid Prep of YopH+pNIC in BL21(DE3)
A 500 mL flask of 160 mL LB and 160 microliters of Kanamycin was made. A colony from plate C grown in the
previous transformation efficiency lab was then taken with a pipette tip and placed into the flask with the LB+Kan.
The flask was then placed into the incubator to shake at 37 degrees Celsius and 175 rpm.
Making of 1L of LB Media
LB media was made within a 2L flask with the following amounts of the appropriate materials:
Tryptone - 10g
Yeast - 5g
NaCl - 10g
1000 mL (1L) of water was added before the addition of the solid ingredients.
This solution was then, after completely mixed, autoclaved on the Liquid5 setting.
My First PCR! (T.T)
PCR was done in order to amplify the purple protein coding sequence in the pGBR-22 plasmid using forward and reverse
primers. After completing the PCR procedure, the four tubes of master mix, dNTP, plasmid, and primer were removed from the PCR machine
and stored within the -20 degree freezer for future gel procedures.
-Expression-
Overnight Small Culture
A small culture of the plasmid Yop-H+pNIC within BL21(DE3) was done within 2 small 125 mL flasks with 50 milliliters of LB within each flask.
Once the appropriate amounts of LB were added to each flask, Plate C from the lab Transformation Efficiency was removed from the fridge
and a colony was taken from the plate using a pipette tip for each flask. Fifty microliters of Kanamycin were then added to each flask,
and the flasks were then placed into the shaking incubator for overnight incubation at 37 degrees Celsius.
Large Culture Step
A large culture was made within a 2L flask using 480mL of LB and 480 microliters of Kanamycin. Eight milliliters of the small culture which was allowed
to incubate overnight were then added to the flask. An additional eight milliliters were added to the flask due to low scores on others' first spectrophotometry runs.
The readings and subsequent additions are shown as follows:
-8 mL addition -Reading 1: .03
-8 mL addition -Reading 2: .05
-5 mL addition -Reading 3: .08
-1 mL addition -Reading 4: .082
-1 mL addition -Reading 5: .1 (11:24 AM)
-45 minute incubation -Reading 6: .163
-30 minute incubation -Reading 7: .329
-15 minute incubation -Reading 8: .474
-12 minute incubation -Reading 9: .52 (1:12 PM)
Sample #0 taken of cell lysate before induction.
Induction Step
IPTG was then added to the flask in the amount of 251 microliters, and then allowed to grow on the shaker for 4 hours at 37 degrees Celsius.
Once grown, Sample #1 was taken.
MidiPrep
MidiPrep was done to purify the pNIC-Bsa4 plasmid DNA within the DH5alpha cells made in a previously done procedure. An error was made in this
procedure when too much buffer was added to each of the 4 tubes in order to re-suspend the pellets. The larger amount made several of the subsequent steps
more difficut, but in the end there was an appropriate result after using nanodrop to determine if plasmid was present within the final tube.
Figure 1. Results of using Nanodrop to determine the concentration of plasmid DNA within the final tube derived through the MidiPrep procedure
The concentrations of 107.1 and 105.7 suggest that there is a useful amount of plasmid within the sample.
DNA Sequencing will be done to further specify the results of the MidiPrep.
(Updated: 06/25/14) DNA Sequencing Results: Figure 1. DNA Sequencing results of the pNIC-Bsa4 plasmid purified through MidiPrep with the pLIC-forward primer. Figure 2: DNA Sequencing results of the pNIC-Bsa4 plasmid purified through MidiPrep with the pLIC-reverse primer.
(Updated: 6/30/14) BLAST Results:
Figure 3: Blast results of known pNIC-Bsa4 sequence against DNA sequencing results of pNIC-Bsa4 with the primer pLIC-for. The query is the known sequence, and the subject is the DNA sequencing results.
The results show 98% identities which is a high enough percentage to verify that the plasmid DNA purified through MidiPrep is in fact pGBR22.
Figure 4: BLAST results of known pNIC-Bsa4 sequence against DNA sequencing results of pNIC-Bsa4 with the primer pLIC-rev. The query is the known sequence, and the subject is the DNA sequencing results.
The results show 98% identities which is a high enough percentage to verify that the plasmid DNA purified through MidiPrep is in fact pGBR22.
Results of Agarose Gel Run (Following PCR)
Week 1 & 2
Results of NanoDrop prior to DNA Sequencing
Figure 1. Nanodrop results of measurement 2 taken with the pGBR-22 plasmid on the
Nucleic Acid setting with "ng/microliter shown in the bottom right hand box. 260/280 and
260/230 readings are also shown. 10 mm Absorbance is shown on the Y axis, and wavelength
in nanometers in shown on the x axis.
Results of DNA Sequencing
Figure 1. DNA Sequencing results shown of the plasmid pGBR-22 with the primer M13R. This is a reverse sequence due to the primer
that was used.
Results of Transformation Efficiency Lab
Figure 1. Control Plate shown with no growth after overnight incubation
at 37 degrees Celsius.No plasmid was present in the 20 microliters of
BL21(DE3) cells which were plated on to LB Agar gel with the antibiotic
Kanamycin. SOC media is also present on this plate.
Figure 2. Plate C shown which was composed of 20 microliters of a
solution of BL21(DE3) cells, 25ng of YopH+pNIC plasmid, and SOC media
which was plated onto LB Agar gel with the antibiotic Kanamycin. Several colonies
were grown on this plate which was incubated at 37 degrees Celsius overnight.
Figure 3. Plate A shown which was composed of 20 microliters of a
solution of BL21(DE3) cells, 1 ng of YopH+pNIC plasmid, and SOC
media which was plated onto LB Agar gel with the antibiotic Kanamycin.
No growth was seen in this plate which might be due to improper dilution
of the plasmid before incorporation into the cells.
Figure 4. Plate B shown which was composed of 20 microliters of
a solution of BL21(DE3) cells, 5 ng of YopH+pNIC plasmid, and SOC
media which was plated onto LB Agar gel with the antibiotic Kanamycin.
No growth was seen in this plate which might be due to improper dilution
of the plasmid before incorporation into the cells.
Week 9
Gel Extraction (7/31/14)
The beginning of gel extraction was carried out by using a razor to physically cut the bands of DNA out of the 4th PCR squared gels. The cut gel was then placed in a round bottom tube and stored in the -20 degree freezer.4th PCR Squared (7/31/14)
A fourth PCR Squared was carried out in almost an identical manner to the 3rd PCR squared in order to run an Agarose gel for use in gel extraction. This time, 2 separate master mixes were made in order to ensure proper concentrations in hopes that the bands seen on this gel which can be used in gel extraction. The agarose gel used was made up .9 g of Agarose and 100 mL of TAE buffer. 6 well combs were used. All DNA was added to each well unlike the previous PCRs. Results are shown below.
The bright bands indicate a good result, and these gels will be used for gel extraction to purify the DNA within.3rd PCR Squared (7/31/14)
A third PCR Squared was carried out in an identical manner to the 2nd PCR Squared in order to run an Agarose gel for use in gel extraction. A different Secondary PCR squared sample was used in hopes that the gel would exhibit bright uniform bands slightly below the 1.5 kb DNA Ladder mark. Results of this run are shown belowThis gel was run much longer than normal which might have caused the result seen above. The concentration of DNA may have also been too low by accident during master mix preparation. This gel will not be used and a 4th PCR Squared will be carried out in hopes of a successful gel.
DNA Sequencing (7/31/14)
Samples 2, 3, 4, and 6 were sent to DNA sequencing using only the forward primer pLIC-for.Results indicate failure as only the beginning and end of the AcpA sequence are matching when the Sequencing Results are blasted against the known sequence.
Mini-Prep (7/31/14)
Samples 1 - 7 of the cultures grown up overnight were purified using Mini-Prep for use in DNA Sequencing. Due to a shortness on time, all samples were only nanodropped once. Results are shown below.Only samples 2, 3, 4, and 6 will be sequenced because their concentrations are high enough for an accurate result.
2nd PCR Squared (7/30/14)
A second PCR Squared was carried out in order to run an Agarose gel for use in gel extraction due to the previous cloning failures.1 master mix with all of its contents doubled was used to create 8 tubes of 50 mL samples. The results of this run are shown below.
The result of this gel indicated that the master mix may have been improperly mixed. The DNA present is not enough to be utilized in gel extraction. A 3rd PCR squared will be carried out in order to attain a successful gel for use in gel extraction.
Master Plate and Cultures (7/30/14)
A master plate and cultures were made from colonies taken from plates A (2:4) & B (2:3) of the plates grown from 7/29/14 to 7/30/14.Master Plate showing colonies 1 through 7 taken from plates A and B.
Cultures were not depicted, but all grew during overnight incubation.
Annealing and Transformation (7/29/14)
3 tubes were made in varying concentrations in order to find a combination that creates successful colonies when plated and incubated.Tubes-
A: 2:4
B: 2:3
C: 3:5
LB+Kan+Suc plates were then made with each of these cultures added. The plates were allowed to grow from 8 pm 7/29/14 to 5 pm 7/30/14
Plate A: 2:4 ratio of Accepting Vector to Insert. Colonies 1 - 6 are shown circled.
Plate B: 2:3 ratio of Accepting Vector to Insert. Colony 7 is shown circled.
Plate C: 3:5 ratio of Accepting Vector to Insert. There was no growth seen on this plate after incubation.
The circled colonies will be used to make the master plate and cultures.
Cohesive End Generation (7/29/14)
A cohesive end generation was done in order to start a new round of cloning incase the DNA sequencing comes back as a failure. The accepting vector was made using 9 uL of cut pNIC-Bsa4 with a concentration of 88.7ng/uL. (Someone else's cut pNIC)
DNA Sequencing (7/29/14)
A Forward and Reverse primer was sent for both Sample 1 and Sample 2.Results indicated failure. A new round of cloning will be started.
MiniPrep (7/29/14)
Miniprep was done on cultures 1 and 2 of the second master plate and cultures in order to prepare them to be sent for sequencing. Results are shown below.Second Master Plate and Cultures (7/28/14)
A new master plate was made using plate A from the second round of plates. Nine cultures were made at the same time using the same colonies that were used to make the plate. Cultures were made in 15 mL conical tubes due to a lack of round bottom culture tubes, and during the incubation, the caps of my samples came off. This possibly introduced contamination. Despite this, only 2 of the cultures made actually grew. The plate and cultures are shown below.DNA Sequencing (7/25/14)
DNA Sequencing was done by adding forward or reverse primer to an appropriate amount of template for each sample. Blasts of the first 5 Blasts of my sequencing results vs. the AcpA DNA sequence are shown below.Sample 1 Forward
Sample 2 Forward
Sample 3 Forward
Sample 4 Forward
Sample 5 Forward
Week 8
MiniPrep (7/25/14)
The cultures which were allowed to incubate overnight were then used in MiniPrep in order to isolate the DNA within the Dh5alpha cells. Nanodrop results are shown below for all 9 samples.
Sample 1
Sample 2
Sample 3:
Sample 4:
Sample 5:
Sample 6:
Sample 7:
Sample 8:
Sample 9:
Making a Master Plate (7/24/14)
A master plate and cultures were made with colonies from Plate C with a 2:3 ratio of Accepting Vector to PCR insert. The cultures were allowed to incubate at 37 degrees from 6 pm to 10:05 am on 7/25/14. All cultures exhibited growth, and all colonies grew.Second Annealing and Transformation (7/24/14)
A second annealing and transformation was done in the case that the cloning done using the previous plates doesn't work.Tubes
A: 2uL AV & 4uL Insert
B: 1uL AV & 5uL Insert
C: 2uL AV & 5uL Insert
These tubes were allowed to shake from 3:57 pm to 4:57 pm.
The plates were allowed to incubate from 6:44 pm on 7/24/14 to 5:00 pm 7/25/14
The next step is to MiniPrep the cultures and store the MasterPlate in the 4 degree fridge.
Re-do of Cohesive End Generation (7/24/14)
A second cohesive end generation was done in order do a second annealing and transformation in the case that the previous transformation doesn't work.
The result of the second cut pNIC was used as the accepting vector in this procedure.
Annealing and Transformation (7/23/14)
This procedure was done with three tubes with different ratios of Accepting Vector to Insert in order to hopefully grow up colonies for use in cloning.Tubes
A: 2uL AV - 4uL Insert
B: 1uL AV - 5 uL Insert
C: 2uL AV - 3uL Insert
These tubes were allowed to shake from 3:44 pm to 6:30 pm due to an unavailability of plates until the time that the tubes were taken out.
The plates were allowed to incubate from 6:44 pm on 7/23/14 to 5:00 pm on 7/24/14
Re-Do of Preparation of pNIC-Bsa4 as the Accepting Vector (7/23/14)
This procedure was done a second time in order to attain a more concentrated result for use in the case that the cloning is not successful. Results are shown below.Figure 1. Results of Samples 1 and 2 for both tubes of PCR cleaned cut pNIC-Bsa4. The concentrations seen for each of the samples are good and indicate that these samples may be used for cohesive end generation.
Cohesive End Generation (7/23/14)
Cohesive End Generation was done for the PCR Inserts as well as the Accepting Vector for use in Annealing and Transformation. The PCR inserts were done with sample from the PCR Cleanup of PCR Squared. The Accepting Vector was made with 14 uL from the cut pNIC-Bsa4 made in a previous procedure.Agarose Gel Run of the cut pNIC-Bsa4 (7/23/14)
An agarose gel run of 10 uL of the cut pNIC-Bsa4 was done in order to ensure that what was in solution was in fact pNIC-Bsa4 and not some form of contamination.Figure 1. Results of Agarose Gel run of sample of pNIC-Bsa4 cut with BsaI-HF. There are two distinct bands showing to places where the pNIC-Bsa4 was cut by the BsaI-HF. The 1 kb Ladder Present in lane 1 seems to not have separated enough for proper use as a reference regarding what sizes the cuts are.
Cidia Gonzalez
07/23/14
RE Digest of pNIC-Bsa4 with BsaI-HF
Lane 1: 1 kb DNA Ladder
Lane 2: Sample of pNIC-Bsa4 cut with BsaI-HF
The results of this gel indicate that what was in solution was a correctly cut pNIC-Bsa4. Since the procedure was successful, this solution will be used for Cohesive End Generation.
Preparation of pNIC-Bsa4 as Accepting Vector (7/22/14)
The vector pNIC-Bsa4 was cut with the enzyme BsaI-HF in order to prepare it to be the accepting vector of the FtAcpa_1 DNA. Results of this procedure after PCR Cleanup are shown below.Figure 1. Results of Nanodrop for samples 1 and 2 for tubes 1 and 2 of PCR cleaned cut pNIC-Bsa4. The concentrations seen for these samples are low which is likely due to the use of 50 uL of elution solution during PCR cleanup.
These concentrations, despite being low, are still usable for cohesive end generation. A second round of this procedure will be done, but I will also move forward to C.E.G.
PCR Cleanup (7/21/14)
PCR Cleanup was done in order to isolate the DNA present from PCR squared. Results are shown below.Figure 1. Sample 1 of PCR squared PCR clean up results shown nanodropped in the graph above. The concentration of this sample is seen to be 139.5 ng/uL which is a good yield of purified DNA.
Figure 2. Sample 2 of PCR squared PCR clean up results shown nanodropped in the graph above. The concentration of this sample is seen to be 140.5 ng/uL which is a good yield of purified DNA.
The average concentration of the PCR Cleaned PCR squared is seen to be 140 ng/uL. This concentration of DNA indicates a good yield which can then be used in cohesive end generation for the PCR inserts.
PCR Squared (7/21/14)
A PCR Squared run was performed using sample 1 of the 10th secondary PCR in order to further amplify the DNA of FtAcpA_1. The annealing time and temperature were 30 seconds and 50 degrees Celsius respectively. The elongation time was set to 50 seconds. The samples were then ran on an agarose gel to view the amplification.
Figure 1. Results of an agarose gel run of PCR squared samples run with an annealing temperature of 50 degrees Celsius and an annealing time of 30 seconds. Elongation time was 50 seconds. Results are appropriate as seen on this gel.Cidia Gonzalez
07/21/14
PCR Squared
Lane 1: 1 kb DNA Ladder
Lane 2: PCR squared sample 1
Lane 2:PCR squared sample 2
Lane 3: PCR Squared Sample 3
Lane 4:PCR Squared sample 4
Week 7
10th Secondary PCR (7/18/14)
A tenth secondary PCR was done with a temperature gradient between 51 and 60 degrees Celsius. The elongation step was increased to 50 seconds, and the annealing step was increased to 30 seconds. For this run, the primers were rediluted in hopes that this would improve the result.Figure 1. Results of agarose gel run of secondary PCR samples run on a gradient from 51 degrees Celsius to 60 degrees celcius with an annealing time of 30 seconds and an elongation time of 50 seconds. In lane 1 is a 1 kb DNA ladder. In lanes 2-9 are samples 1 through 8 of secondary PCR. Bands are seen in the appropriate place for all samples except sample 4 which was incorrectly pipetted into the well before running the gel. These results are viable for use in PCR squared.
Cidia Gonzalez
07/18/14
10th Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR Sample (51 degrees)
Lane 3: Secondary PCR Sample (51.9 degrees)
Lane 4: Secondary PCR Sample (53.1 degrees)
Lane 5: Secondary PCR Sample (54.6 degrees)
Lane 6: Secondary PCR Sample (56.6 degrees)
Lane 7: Secondary PCR Sample (58.3 degrees)
Lane 8: Secondary PCR Sample (59.4 degrees)
Lane 9: Secondary PCR Sample (60 degrees)
The results of this run indicate success and will be used in PCR squared to further amplify the DNA. The light bands seen at 3.0 kDa are perhaps contamination or some kind of clumping of the DNA. Since sample one at 51 degrees appears to have the least contamination, this sample will be used for PCR squared. The PCR squared will be done with an annealing temperature of 50 degrees Celsius and an annealing time of 30 seconds. The elongation time will be 50 seconds. After the PCR squared is done, the samples will be ran on an Agarose gel to view the amplification.
9th Secondary PCR
A 9th secondary PCR was done with a temperature gradient between 53 and 63 degrees Celsius. The elongation step was increased to 50 seconds.A picture was not taken for this gel run, but the result was a clean gel with no bands or smears in any of the lanes. The error made in this run was most likely due to improper mixing of the samples prior to PCR.
8th Secondary PCR
AN 8th Secondary PCR was done with a temperature gradient between 52 and 61 degrees Celsius. The elongation step was increased to 50 seconds.Figure 1. Results of agarose gel run of secondary pcr samples for Chris T. and Cidia G. In lane 1 is a 1 kb DNA ladder. In lane 2 is the secondary pcr sample for Chris T. In lanes 3 through 10 are secondary pcr samples 1 -8 for Cidia G. There is a small smear low on the gel in lane 2 for Chris’ sample, which is not the expected result. There are no bands or smears in lanes 3 through 10 indicating failure for Cidia G.
Cidia G. / Chris T.
07/17/14
Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR sample for Chris T.
Lane 3: Secondary PCR sample 1 (Cidia G.)
Lane 4: Secondary PCR sample 2 (Cidia G.)
Lane 5: Secondary PCR sample 3 (Cidia G.)
Lane 6: Secondary PCR sample 4 (Cidia G.)
Lane 7: Secondary PCR sample 5 (Cidia G.)
Lane 8: Secondary PCR sample 6 (Cidia G.)
Lane 9: Secondary PCR sample 7 (Cidia G.)
Lane 10: Secondary PCR sample 8 (Cidia G.)
Nothing was seen in my lanes for these samples, and this is likely due to PCR error. Another secondary PCR will be done to hopefully get a good result.
Fourth Primary PCR
A primary PCR was done using the remade oligo mix in order to attain a result usable in continuing Secondary PCR.Figure 1. Results of Agarose gel run of Primary PCR samples made using new oligo mix for Cidia Gonzalez, Nikki Weber, and Chis Tran. In lane 1 is a 1 kb DNA ladder. In lane 2 is the primary PCR sample for Cidia G. In lane 3 is the primary PCR sample for Nikki W. In lane 3 is the primary PCR sample for Chris T. The fact that the lanes are showing bands and not smears as expected is not normal. The cause of this will need to be determined before these results may be used in secondary PCR or discarded.
Cidia Gonzalez/ Nikki Weber/ Chris Tran
07/16/14
Primary PCR with New Oligo Mix
VDS Summer 2014
Lane 1: 1 kb DNA Ladder
Lane 2: Primary PCR sample (Cidia G.)
Lane 3: Primary PCR sample (Nikki W.)
Lane 4: Primary PCR sample (Chris T.)
Remaking Oligo Mix
Oligo mix was remade using 1 microliter each of Plate A: Wells E5-H6 and 62 microliters of water.Seventh Secondary PCR
A seventh Secondary PCR was done with a temperature gradient and 8 samples in order to attain a viable result for use in PCR squared.Figure 1. Results of agarose gel run of 7th Secondary PCR with a temperature gradient on the annealing step between 56 and 63 degrees Celsius. In lane 1 is a 1 kb DNA Ladder. In lanes 2 through 9 are samples 1 – 8 of Secondary PCR. No bands are seen which is most likely due to error during PCR. 31.5 uL of water was probably not added to each sample before PCR was begun, which is possibly the reason that no bands are seen.
07/16/14
7th Secondary PCR
Cidia Gonzalez
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR Sample 1 (56 degrees)
Lane 3: Secondary PCR Sample 2 (56.7 degrees)
Lane 4: Secondary PCR Sample 3 (57.6 degrees)
Lane 5: Secondary PCR Sample 4 (58.8 degrees)
Lane 6: Secondary PCR Sample 5 (60.4 degrees)
Lane 7: Secondary PCR Sample 6 (61.7 degrees)
Lane 8: Secondary PCR Sample 7 (62.5 degrees)
Lane 9: Secondary PCR Sample 8 (63 degrees)
The results of this run are most likely due to the accidental omission of 31.5 uL of autoclaved nanopure in each sample before PCR. Oligo mix will be remade and primary PCR will be redone in order to continue secondary PCR.
Sixth Secondary PCR
A sixth Secondary PCR was done with a temperature gradient and 8 samples in order to attain a viable result for use in PCR squared.Figure 1. Results of Agarose Gel of Samples 1 – 8 of the 6th Secondary PCR done with a temperature gradient between 57 degrees Celsius and 64 degrees Celsius. Bands are shown in all lanes; However, the position of the bands on the gel indicates a much smaller size of DNA is being amplified than what the target should be.
07/15/14
Cidia Gonzalez
Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Sample 1 (57 degrees)
Lane 3: Sample 2 (57.7 degrees)
Lane 4: Sample 3 (58.6 degrees)
Lane 5: Sample 4 (59.8 degrees)
Lane 6: Sample 5 (61.4 degrees)
Lane 7: Sample 6 (62.7 degrees)
Lane 8: Sample 7 (63.5 degrees)
Lane 9: Sample 8 (64 degrees)
The bands seen above are similar in size to the bands seen in the 5th secondary PCR which is indicative of failure. Another PCR will be done with a temperature gradient similar to this one but with a longer elongation step in hopes of amplifying a larger segment of DNA.
Fifth Secondary PCR
A fifth Secondary PCR was done with a temperature gradient and 5 samples in order to attain a viable result for use in PCR squared.Figure 1. Results of Agarose Gel run of the 5th Secondary PCR samples 1-5. A 1 kb DNA Ladder is in lane 1, and samples 1-5 are in lanes 2 through 6. The bands seen in lanes 3 and 4 are a successful result, and sample 2 in lane 4 will be used for PCR squared.
Cidia Gonzalez
07/14/14
Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR Sample 1
Lane 3: Secondary PCR Sample 2
Lane 4: Secondary PCR Sample 3
Lane 5: Secondary PCR Sample 4
Lane 6: Secondary PCR Sample 5
Temp Gradient from 55.5 to 59 degrees Celsius.
There is no certainty regarding which sample received which temperature.
After further analysis, the result of this PCR was proved to be a failure of sorts as the bands seen are too small in size. Ideally, the bands should be higher in the gel relative to the ladder to indicate the larger amplified DNA. Another Secondary PCR will be done with a larger gradient in hopes of achieving a viable result.
Fourth Secondary PCR
A fourth Secondary PCR was done in order to attain a viable result for use in PCR squared.Figure 1. Results of Agarose Gel of 4th Secondary PCR Sample with no viable results displayed in the 2nd lane where the 4th secondary PCR sample was placed. The result may be due to improper PCR and a temperature gradient may be added to the protocol in order to achieve a result.
07/14/14
Cidia Gonzalez
Secondary PCR
Lane 1: 1 kb DNA Ladder
Lane 2: Secondary PCR Sample
The results seen here indicate failute and the PCR protocol will be further modified to incorporate a temperature gradient from 55.5 degrees Celsius to 59 degrees Celsius for 25 seconds as the annealing step with 5 individual samples.
Week 6
Third Secondary PCR
A third Secondary PCR was done in order to attain a viable result for use in PCR squared.Figure 1. Third run of Secondary PCR on target. In lane 2 is a 1 kb DNA ldder. In lanes 3 and 4 are Charina's RE Digest samples. Lane 5 is empty. Lane 6 is Nikki and Carolyn's Secondary PCR sample. Lane 7 is empty. In lane 8 is Cidia's Secondary PCR sample. Results appear unsuccessful for Secondary PCR samples seen in lanes 6 and 8.
Nikki W., Carolyn T., Cidia G.
7/11/14
VDS Summer 2014
Secondary PCR
Lane 1: Empty
Lane 2: 1 kb DNA Ladder (5 uL)
Lane 3: RE Digest Sample #1 (Charina)
Lane 4: RE Digest Sample #2 (Charina)
Lane 5: Empty
Lane 6: Secondary PCR sample (Nikki & Carolyn)
Lane 7: Empty
Lane 8: Secondary PCR sample (Cidia)
Since this secondary PCR was unsuccessful, the PCR protocol annealing step will be modified to better fit the target and primers in order to hopefully achieve a positive result.
Second Secondary PCR
A second Secondary PCR was done in order to attain a viable result for use in PCR squared.Figure 1. Secondary PCR samples for Andee, Nikki, Carolyn, and Cidia. The first lane is skipped while the second lane has a 1 kb ladder. Lane three has Andee’s secondary PCR (EhPTP) while the following lanes are Nikki and Carolyn’s secondary PCR and Cidia’s secondary PCR. A visible band is seen for Andee’s samples while the following two samples did not result in bands, indicative that secondary PCR was not successful.
Andee F., Cidia G., Nikki W. and Carolyn T.
07/10/14
Secondary PCR
Lane 1: empty
Lane 2: 1 kb ladder
Lane 3: Andee’s PCR sample
Lane 4: Nikki and Carolyn’s PCR sample
Lane 5: Cidia’s PCR sample
Remaining lanes: empty
There were no bands seen for this gel run which would be due to improper mixing of sample or inefficient PCR. PCR may have to be modified according to the specific primers and gene in order for it to work. A third secondary PCR will be done before PCR is modified to hopefully attain a viable result.
First Secondary PCR
Secondary PCR was done to amplify the full length gene from the pool of DNA fragments in the Primary PCR reaction.Figure 1. Agarose gel of Secondary PCR. Lane 1 is empty. Lane 2 contains the DNA 1kb ladder, lane 3 has 12 uL secondary PCR sample (Nikki & Carolyn) and lane 4 has 12 uL secondary PCR sample (Cidia).
7/10/14
VDS Summer
Cidia, Nikki & Carolyn
Lane 1: Empty
Lane 2: 1kb DNA Ladder
Lane 3: Secondary PCR Nikki W & Carolyn T.
Lane 4: Secondary PCR Cidia
Nothing showed up in either lane which is likely due to improper mixing of the sample prior to PCR. A new secondary PCR will be done in hopes of attaining a viable result for use in PCR squared.
2nd Re-Do of Primary PCR
Primary PCR was done a third time in an identical manner to the two previous times in order to attain a viable result for use in secondary PCR.Figure 1. Results of 3rd Primary PCR of Andee’s sample in lane 3 and Cidia’s sample in lane 4. In lane 2 is a 1 kb DNA Ladder. The absence of any result in lane 3 where Andee’s sample should have shown is most likely a result of improper mixing of the sample before PCR. An additional Primary PCR will need to be done in order to get a result viable enough to use in Secondary PCR. The smear seen in lane 4 is the expected result with a high enough yield to continue on to Secondary PCR.
07/09/14
Primary PCR
Andee F. / Cidia G.
Lane 1: Empty
Lane 2: 1 kB DNA Ladder
Lane 3: Primary PCR Sample (Andee F.)
Lane 4. Primary PCR Sample (Cidia G.)
Tail Primer Dilution
Tail Primers were diluted from the powder to a liquid solution using appropriate amounts of TE Buffer in order to reach a stock concentration of 100 mM for long term storage. The stock solution was then diluted to 20mM by adding 160 microliters of 10 mM Tris with a pH of 8.0 to 40 microliters of stock.FtAcpA
1st Re-Do of Primary PCR
Primary PCR was done in an identical manner to the previous run in order to attain a viable result for secondary PCR.Figure 1. Results of Agarose Gel run of primary PCR samples in lanes 3 and 4 for Andee and Cidia and PCR squared samples in lanes 6-9 for Brianna. A 1 kn ladder is shown in lane 2. The results seen in lanes 3 and 4 are not ideal, but do not suggest failure. Light smears are seen which are not undesired results. However, darker smears would be indicative of concentrations high enough to move on to secondary PCR. The PCR Squared samples seen in lanes 6 through 9 are the desired result with possible contamination or uncompleted assembly of the gene seen in several places in each lane.
Cidia Gonzalez / Andee Fonseca / Xenia Gonzalez
07/08/2014
Primary PCR / PCR Squared
Lane 1: Empty
Lane 2: 1 kb DNA Ladder
Lane 3: Primary PCR Sample (Andee F.)
Lane 4: Primary PCR Sample (Cidia G.)
Lane 5: Empty
Lane 6: PCR Squared KpblaGES5 (Xenia G.)
Lane 7: PCR Squared KpblaGES5 (Xenia G.)
Lane 8: PCR Squared KpblaGES5 (Xenia G.)
Lane 9: PCR Squared KpblaGES5 (Xenia G.)
Restriction Enzyme Digest
A restriciton enzyme digest was done on the plasmid pGBR22 with the enzymes EcoRI and PvuII both separately and together. All 3 samples were run in order to view the results of a restriction enzyme digest for future reference. The result is seen below.Figure 1. Results of agarose gel run of samples of pGBR22 cut with restriction enzymes EcoRI, PvuII, and with both EcoRI and PvuII. In lane 2 is the 1 kb DNA ladder. In lane 3 is the uncut pGBR22 with a concentration of 100 ng. Lanes 4-6 are Andee’s samples of plasmid and restriction enzyme with 4 having only EcoRI, 5 having PvuII, and 6 having both EcoRI and PvuII. The results seen above for these lanes are ideal as there are clear bands in the expected positions based on the segments created after digest with the specific enzyme or enzymes. Lanes 7-9 are Cidia’s samples of plasmid and restriction enzyme with 7 having only EcoRI, 8 having PvuII, and 9 having both EcoRI and PvuII. The results seen above for these lanes are not ideal as there are contaminating bands seen below the first cuts shown in lanes 8 and 9. Other than these bands, the bands shown are appropriate based on the segments created after digest with the specific enzyme or enzymes.
07/08/2014
Cidia Gonzalez / Andee Fonseca
Restriction Enzyme Digest
Lane 1:Empty
Lane 2: 1 kb DNA Ladder
Lane 3: Uncut plasmid pGBR22 (100 ng)
Lane 4: pGBR22 with EcoRI (AndeeF.)
Lane 5: pGBR22 with PvuII (Andee F.)
Lane 6: pGBR22 with EcoRI and PvuII (Andee F.)
Lane 7: pGBR22 with EcoRI (Cidia G.)
Lane 8: pGBR22 with PvuII (Cidia G.)
Lane 9: pGBR22 with EcoRI and PvuII (Cidia G.)
Week 5
Concentrating Results of FPLC and Storage
The two 15mL conical tubes taken as a result of FPLC done yesterday were concentrated in concentration tubes run at 8000 g's for 10 minutes until all had been concentrated. After all was concentrated, nanodrop was done on the concentrated tubes for analysis, and the tubes were stored.FPLC
FPLC Gel Filtration was done in order to further purify the protein present in Elution 1 which was obtained by using Ni-NTA affinity purification. This filtration was done based on differences in size. In order to prepare the sample for FPLC, it was concentrated to 1 mL in a concentrating tube at 8,000 g's for 20 minutes. Once concentrated, the sample was poured into a microcentrifuge tube and taken to the biotech lab for FPLC. FPLC was run according to protocol with no changes. After FPLC, tubes 29 though 37 were taken and placed into a 15 mL concical tube due to the peak that was present at 44 kDa, and tubes 39 through 46 were taken and placed into a 15 mL conical tube due to the peak that was present at 33 kDa which is most likely the protein of YopH. The 44 kDa peak is most likely another protein as YopH is somwhere close to 32 or 33 kDa.Results of FPLC run
pLIC Gel Run
An agarose gel was run for the samples obtained after running the pLIC PCR yesterday. The sample was ran in a 1% agarose gel with a 1kb ladder. The gel was run at 105V for approcimately 35-40 minutes until the sample was about 3/4 of the way down the gel. After the gel was done, it was photographed with the UV viewer.Figure 1. Results of the agarose gel run of pNIC-Bsa4 for Cidia on the left and Andee on the right. The 1 kb ladders are visible in lanes 1 and 6. Samples A-D for Cidia are shown in lanes 2 through 5. Samples A-D for Andee are shown in lanes 7-10. There are what we believe to be contaminated bands seen in lanes 7 and 8 around the 1.0 mark of the ladder. The pNIC bands are shown in lanes 2-4 for Cidia and in lanes 7-9 for Andee slightly above the 2.0 mark of the ladder. The increasing concentrations of the DNA in each subsequent lane are appropriate results relative to the increasing concentrations of samples 1-C. Lanes 5 and 10 show no bands in the region where pNIC would be due to Sample D being a control containing no template.
Lane 1: 1 kb DNA Ladder
Lane 2: 0.0196 ng pNIC-Bsa4 (Cidia G.)
Lane 3: 0.196 ng pNIC-Bsa4 (Cidia G.)
Lane 4: 1.96 ng pNIC-Bsa4 (Cidia G.)
Lane 5: No template control (Cidia G.)
Lane 6: 1 kb DNA Ladder
Lane 7: .0362 ng pNIC-Bsa4 (Andee F.)
Lane 8: 0.362 ng pNIC-Bsa4 (Andee F.)
Lane 9: 3.62 ng pNIC-Bsa4 (Andee F.)
Lane 10: No template control (Andee F.)
Primary PCR Gel Run
An agarose gel was run for the sample obtained after running Primary PCR yesterday. The sample was ran in a 1% agarose gel with a 1kb ladder. The gel was run at 105V for approximately 45 minutes until the sample was about 3/4 of the way down the gel. After the gel was done, it was photographed with the UV viewer. When running this gel, only half of the sample should have be used. Since we used all of the sample, we had to add a larger amount of gel loading buffer. We will need to run a second Primary PCR in order to run our Secondary PCR.Figure 1. Results of agarose gel run of the primary PCR samples for Cidia on the left and Andee on the right. Lanes 1 and 4 show a 1 kb DNA ladder. Lane 2 shows the primary PCR sample for Cidia, and lane 5 shows the primary PCR sample for Andee. The smeared look of the samples in the these lanes is the expected result due to the nature of the sample.
Lane 1: 1 kb DNA Ladder
Lane 2: Primary PCR Sample (Cidia G.)
Lane 3: Empty
Lane 4: 1 kb DNA Ladder
Lane 5: Primary PCR Sample (Andee F.)
Lane 6: Empty.
Making FPLC Buffer
FPLC buffer was made using 6.06 g of Tris, 8.77g of NaCL, and 154.25 mg of DTT. DTT was not necessary, but was added due to obtaining the incorrect protocol. The DTT used was stored within the cabinet near the flammables cabinet and was not stored within the 4 degree fridge as it should have been. The pH of the buffer was then brought down to 8.0 by the addition of HCl to make it more acidic. The buffer was then ran through a bottle top filter in order to remove impurities and was then degassed for approximately 20 minutes.pLIC PCR
PCR was done in order to amplify pNIC-Bsa4 using the primers pLIC-for and pLIC-rev. The samples were prepped according to protocol and thermocycled according to protocol. After PCR was done for these samples, the samples were stored in the -20 degree freezer overnight for running an agarose gel the next day.Primary PCR
PCR was done in order to fill the gaps between my oligos and piece together a full DNA sequence by adding appropriate amounts of 5x reaction buffer, 2mM dNTPs, oligo mix, 1U/uL Q5 hotstart polymerase, and sterile dH2O to a microcentrifuge and then thermocycling according to protocol. The tube was then stored in the -20 degree freezer overnight for running an agarose gel the next day.Making Oligo Mix
Since the oligos of my CDS came in, oligo mix was made by added 57 microliters of autoclaved nanopure to a microcentrifuge tube and then adding 1 microliter of each stock primer from the oligo box according to the wells that were designated for my target.Tail Primers Design and Order
Tail primers were designed for my target, a secreted phosphatase of the organism Francisella tularensis and placed on the wish list for later ordering. Primers were designed in order to incorporate my target into the organism pNIC-Bsa4 for PCR amplifying the CDS of my gene of interest.TACTTCCAATCCATGGACGTGAATAATTCTAAGCCGAACGATTACGGTACCCTGGTTAAAATCGAACAGAAA
CTGTTTAACAACGCGAATACGCTCAAAACGACCACCCCGATTAAACACGTAGTCATTATC
TTCCAGGAGAATAACTCTTTTGATCGTTACTTCGGTATGTACCCGAATGCGAAGAATCCG
GAAGGTGAACCAAAGTTTGTTGCGAAAGAAAACACCCCAAATGTTAACGGCCTCACCAAA
CAGCTGCTCGAAAATAACCCGAACACCAAAAATCCGTACCGCCTGGATCGCAACTTCCAG
CCGTGCTCTCAGAACCACGAATACCACCAGGAAATCTCTTCTTTCAATGGTGGCCTGATG
AATAAGTTCGTCGAACATGGTGGTCACGACAATGACACCTACAAACAGAATTGCGATGGT
CAGGTGATGGGCTACTATGATGGCAATACTGTTACCGCGCTGTGGAATTACGCGCAGAAC
TTCGCGCTGAATGACAACACCTTTGGTACTACCTTCGGTCCGTCTACCCCGGGTGCCCTG
AACCTGGTTGCGGGTGCAAACGGTCCGGCGATGTCTCCGTCTGGCAACCTCGAGAACATC
GAAAACAACTACATCATTGACGACCCTAACCCGTATTATGACGACTGCTCTTACGGCACC
TCTAAATCTGGCGACACCAACACTGCGGTTGCTAAGATCACGGATGGTTACAACATCGGT
CACTACCTCACCCAAAAAGGTATCACTTGGGGTTGGTTTCAAGGCGGCTTCAAACCGACC
TCTTACTCTGGTAAGACGGCGATTTGTGACGCCATGTCTACCAACAAGTTCGGTGTTAAA
TCTCGTGACTATATCCCGCACCACGAGCCTTTCAACTATTGGAAGGAGACCTCCAATCCA
CACCACCTCGCGCCGAGCGACGACAAATACATTGGTTCTAATGATCAAGCGAATCACCAA
TACGACATCTCTGAATTCTGGAAGGCGCTCGACCAGAACAACATGCCTGCCGTTTCTTAC
CTGAAAGCTCCGGGTTACCAGGATGGCCACGGTGGCTACTCCAACCCACTGGACGAACAG
GAATGGCTCGTTAATACCATCAACCGTATCCAGCAGTCTAAAGACTGGGACTCTACCGCT
ATTATCATCATTTACGATGACAGCGACGGTGATTACGATCACGTTTACTCTCCAAAGTCT
CAATTCTCTGACATCAAGGGCCGTCAAGGTTATGGTCCGCGTCTGCCGATGCTGGTTATC
AGCCCGTATGCAAAAGCTAACTACGTTGACCACTCTCTGCTGAATCAGGCGTCTGTCCTG
AAATTCATCGAATACAACTGGGGTATCGGTTCCGTATCTAAATACTCTAACGACAAGTAT
TCTAACAATATCCTGAATATGTTTGACTTCAACAAAGAGCAAAAAACCCTGAAACTGATC
CTGGACCCGAAAACTGGTCTCGTTATGGATAAACTGAACTAACAGTAAAGGTGGATA
Filtered DNA of my target CDS with tail primers added and highlighted.
Primers ordered shown above as the "Forward Primer" and the "Reverse Complement" of the Reverse primer. These were made by attaching the primer sequences to the first and last 18-20 bp of the sequence.
Ordered primers were: FtAcpA_1-for and FrAcpA_1-rev
Week 4
Protein Characterization
Characterization was done by running samples 0 through 6 with an SDS Page gel which was made previously. The samples were prepped according to protocol and the gel was placed into the tank filled with buffer. Samples were then added between the glass plates into the wells and the gel was run at 200V for approximately 35-40 minutes until the samples were visibly at the lower part of the gel. After the electrophoresis was done, the gel was removed, stained, and dried according to protocol.Figure 1. Characterization Results of gel electrophoresis of YopH samples taken over the course of Expression and Purification. What is in each lane is clearly marked in the image. Elution 1 and Elution 2 are of the most importance as this is where the purified protein is supposed to be present. In lane 8 where elution 1 is present, the bands other than the large dark one should not be present. The yopH protein is clearly present more strongly than other proteins, though. This is a favorable result. There is also some of the YopH protein present in the elution 2, but the concentration in this sample was less than that of Elution 1.
Making SDS Page Gel for Protein Characterization
SDS Page gel was made using a 12% resolving/separating gel and a 5% stacking gel. Before the addition of the resolving/separating gel, the gel drying stand kept leaking due to a small crack in the larger glass plate which enabled fluid to seep out. After replacing the slide, the gel no longer leaked and was made according to protocol.Protein Purification
The protein was purified by Ni-NTA affinity purification through a series of filtration steps involving Ni-NTA buffer, a nickle column, and wash and elution buffers. Samples 3 through 6 were taken during this procedure after certain steps. After elutions 1 and 2 were taken, the OD of each was measured at 280 nm on the spectrophotometer.Figure 1. Results of Nanodrop to determine the concentration of protein found in Elutions 1 and 2 which were obtained after protein purification. Elution 1 shows a good concentration of protein at 2.67 mg/mL measured at 280 nm. Elution 2 shows a good concentration of protein at .79 mg/mL measured at 280 nm. The concentration of protein elution 1 was expected to be higher than that of elution 2. Ideally, the concentration of elution 2 should be closer to zero as most of the protein should have come out in the first elution.
Re-Do of Agarose Gel (Third Time)
An agarose gel run of the samples made as a result of PCR done earlier today was carried out as a result of yesterday's unsuccessful gel.This gel was ran almost identically to the one ran yesterday with the exception of the voltage which, for the third gel, was 105V. After the gel had
been running for approximately 1 minute, a 1000kb DNA ladder was added to well 10 of the gel. This addition did not float to the bottom of the gel as expected,
most likely due to the fact that the gel was already running. The results of the gel are shown below:
Re-Do of PCR (Third Time)
PCR was done a third time due to the unsuccessful gel ran yesterday. This procedure was ran identically to the procedure ran yesterday.Re-Do of Large Culture Expression & Inoculation
YopH+pNIC Bsa4 in BL21(DE3) was grown up overnight in two 250 mL flasks with 50 mL of LB Media and 50 microliters ofKanamycin in each. In the morning, 500 mL of LB and 500 microliters of Kan were placed in a 2L flask and the following additions and readings
were made:
Added: 16 mL YopH/ Reading 1: 0.046
Added: 8 mL YopH/ Reading 2: 0.095
Added: 0 mL YopH/ Reading 3: 0.085
Added: 1 mL YopH/ Reading 4: 0.085
Added: 1 mL YopH/ Reading 5: 0.101
Incubated for 45 minutes/ Reading 6:
Incubated for 30 minutes/ Reading 7:
Incubated for 15 minutes/ Reading 8:
Incubated for 9 minutes/ Reading 9:
258.5 microliters of IPTG added
Flask was placed to incubate for 4 hrs until 5:35 PM
Culture was then placed into a 500 mL cylindrical bottle and centrifuged at 5800 rpm for 20 minutes.
- Centrifuged on J20 rotor setting instead of J10 by accident.**
Supernatant was then trashed, and cell pellet was weighed and found to be 2.43 grams.Cell pellet was then resuspended in lysis buffer, transferred to a 15 mL conical tube, and stored in the -80 degree celsius freezer.
Second Gel Run
The second gel run was done with 5 mL of gel loading buffer in each sample tube. 20 mL of each samplewith blue juice were put into each well. The gel was ran at 100V for approximately 40 minutes until the samples were about 3/4
of the way down the gel. The results of this gel are shown below:
Second PCR
A second PCR was done today so that a second gel may be run due to the failure of the last agarose gel run.This PCR procedure was done using the same materials as the last PCR to achieve a similar result which will
hopefully provide a viable result following the gel run.
DNA Sequencing Analysis
The DNA sequencing results of pGBR22 with the primer M13 Reverse were analyzed against the known sequence todetermine if the sequence found through sequencing was correct. The portion of the pGBR22 that was read by the M13
Reverse was then placed into the pGEMt backbone. The results of a gel senario involving certain enzymes and the plasmid
were then also analyzed.
Week 3
Results of Making Plates of LB Agar + Amp
After making and autoclaving 200 mL of LB Agar, 400 microliters of Ampicillin were added. The LB+Ampwas then transferred onto 10 different plates with each plate having 20 mL each. Upon wrapping the plates
with saran wrap for storage in the 4 degree fridge, five of the plates fell. Four of the five were compromised and
thrown away, but one was saved and stored for a total of six stored plates.
Results of Transformation of Competent Cells for Plasmid Prep of YopH+pNIC in BL21(DE3)
A 500 mL flask of 160 mL LB and 160 microliters of Kanamycin was made. A colony from plate C grown in theprevious transformation efficiency lab was then taken with a pipette tip and placed into the flask with the LB+Kan.
The flask was then placed into the incubator to shake at 37 degrees Celsius and 175 rpm.
Making of 1L of LB Media
LB media was made within a 2L flask with the following amounts of the appropriate materials:Tryptone - 10g
Yeast - 5g
NaCl - 10g
1000 mL (1L) of water was added before the addition of the solid ingredients.
This solution was then, after completely mixed, autoclaved on the Liquid5 setting.
My First PCR! (T.T)
PCR was done in order to amplify the purple protein coding sequence in the pGBR-22 plasmid using forward and reverseprimers. After completing the PCR procedure, the four tubes of master mix, dNTP, plasmid, and primer were removed from the PCR machine
and stored within the -20 degree freezer for future gel procedures.
-Expression-
Overnight Small Culture
A small culture of the plasmid Yop-H+pNIC within BL21(DE3) was done within 2 small 125 mL flasks with 50 milliliters of LB within each flask.Once the appropriate amounts of LB were added to each flask, Plate C from the lab Transformation Efficiency was removed from the fridge
and a colony was taken from the plate using a pipette tip for each flask. Fifty microliters of Kanamycin were then added to each flask,
and the flasks were then placed into the shaking incubator for overnight incubation at 37 degrees Celsius.
Large Culture Step
A large culture was made within a 2L flask using 480mL of LB and 480 microliters of Kanamycin. Eight milliliters of the small culture which was allowedto incubate overnight were then added to the flask. An additional eight milliliters were added to the flask due to low scores on others' first spectrophotometry runs.
The readings and subsequent additions are shown as follows:
-8 mL addition -Reading 1: .03
-8 mL addition -Reading 2: .05
-5 mL addition -Reading 3: .08
-1 mL addition -Reading 4: .082
-1 mL addition -Reading 5: .1 (11:24 AM)
-45 minute incubation -Reading 6: .163
-30 minute incubation -Reading 7: .329
-15 minute incubation -Reading 8: .474
-12 minute incubation -Reading 9: .52 (1:12 PM)
Sample #0 taken of cell lysate before induction.
Induction Step
IPTG was then added to the flask in the amount of 251 microliters, and then allowed to grow on the shaker for 4 hours at 37 degrees Celsius.Once grown, Sample #1 was taken.
MidiPrep
MidiPrep was done to purify the pNIC-Bsa4 plasmid DNA within the DH5alpha cells made in a previously done procedure. An error was made in thisprocedure when too much buffer was added to each of the 4 tubes in order to re-suspend the pellets. The larger amount made several of the subsequent steps
more difficut, but in the end there was an appropriate result after using nanodrop to determine if plasmid was present within the final tube.
Figure 1. Results of using Nanodrop to determine the concentration of plasmid DNA within the final tube derived through the MidiPrep procedure
The concentrations of 107.1 and 105.7 suggest that there is a useful amount of plasmid within the sample.
DNA Sequencing will be done to further specify the results of the MidiPrep.
(Updated: 06/25/14) DNA Sequencing Results:
Figure 1. DNA Sequencing results of the pNIC-Bsa4 plasmid purified through MidiPrep with the pLIC-forward primer.
Figure 2: DNA Sequencing results of the pNIC-Bsa4 plasmid purified through MidiPrep with the pLIC-reverse primer.
(Updated: 6/30/14) BLAST Results:
Figure 3: Blast results of known pNIC-Bsa4 sequence against DNA sequencing results of pNIC-Bsa4 with the primer pLIC-for. The query is the known sequence, and the subject is the DNA sequencing results.
The results show 98% identities which is a high enough percentage to verify that the plasmid DNA purified through MidiPrep is in fact pGBR22.
Figure 4: BLAST results of known pNIC-Bsa4 sequence against DNA sequencing results of pNIC-Bsa4 with the primer pLIC-rev. The query is the known sequence, and the subject is the DNA sequencing results.
The results show 98% identities which is a high enough percentage to verify that the plasmid DNA purified through MidiPrep is in fact pGBR22.
Results of Agarose Gel Run (Following PCR)
Week 1 & 2
Results of NanoDrop prior to DNA Sequencing
Figure 1. Nanodrop results of measurement 2 taken with the pGBR-22 plasmid on the
Nucleic Acid setting with "ng/microliter shown in the bottom right hand box. 260/280 and
260/230 readings are also shown. 10 mm Absorbance is shown on the Y axis, and wavelength
in nanometers in shown on the x axis.
Results of DNA Sequencing
Figure 1. DNA Sequencing results shown of the plasmid pGBR-22 with the primer M13R. This is a reverse sequence due to the primer
that was used.
Results of Transformation Efficiency Lab
Figure 1. Control Plate shown with no growth after overnight incubation
at 37 degrees Celsius.No plasmid was present in the 20 microliters of
BL21(DE3) cells which were plated on to LB Agar gel with the antibiotic
Kanamycin. SOC media is also present on this plate.
Figure 2. Plate C shown which was composed of 20 microliters of a
solution of BL21(DE3) cells, 25ng of YopH+pNIC plasmid, and SOC media
which was plated onto LB Agar gel with the antibiotic Kanamycin. Several colonies
were grown on this plate which was incubated at 37 degrees Celsius overnight.
Figure 3. Plate A shown which was composed of 20 microliters of a
solution of BL21(DE3) cells, 1 ng of YopH+pNIC plasmid, and SOC
media which was plated onto LB Agar gel with the antibiotic Kanamycin.
No growth was seen in this plate which might be due to improper dilution
of the plasmid before incorporation into the cells.
Figure 4. Plate B shown which was composed of 20 microliters of
a solution of BL21(DE3) cells, 5 ng of YopH+pNIC plasmid, and SOC
media which was plated onto LB Agar gel with the antibiotic Kanamycin.
No growth was seen in this plate which might be due to improper dilution
of the plasmid before incorporation into the cells.